ID: 903321992_903321998

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 903321992 903321998
Species Human (GRCh38) Human (GRCh38)
Location 1:22548748-22548770 1:22548779-22548801
Sequence CCGTGTGACCCAGGGCAACTGAC TCTAGGCCTCCTCTGCAAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 382} {0: 1, 1: 0, 2: 2, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!