ID: 903323078_903323089

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903323078 903323089
Species Human (GRCh38) Human (GRCh38)
Location 1:22554078-22554100 1:22554130-22554152
Sequence CCCACAGCCTGGCTCCTTCTCCA CAAGGTAGCAGCCAGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 488} {0: 1, 1: 0, 2: 4, 3: 29, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!