ID: 903342047_903342052

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 903342047 903342052
Species Human (GRCh38) Human (GRCh38)
Location 1:22660763-22660785 1:22660800-22660822
Sequence CCTTCTTTTGGTCTCAGTGATCT CTGCTTTTCCAGGGCTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 681} {0: 1, 1: 0, 2: 4, 3: 31, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!