ID: 903355626_903355633

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 903355626 903355633
Species Human (GRCh38) Human (GRCh38)
Location 1:22745644-22745666 1:22745660-22745682
Sequence CCTCAGTTTCCTTTATCTCTGAA CTCTGAAAGGGGGTGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 77, 4: 556} {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!