ID: 903369893_903369895

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 903369893 903369895
Species Human (GRCh38) Human (GRCh38)
Location 1:22828425-22828447 1:22828459-22828481
Sequence CCTCTTCTACATCTGCACGGATG GACCCAATCCTTGTTCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99} {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!