ID: 903370506_903370515

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903370506 903370515
Species Human (GRCh38) Human (GRCh38)
Location 1:22832113-22832135 1:22832152-22832174
Sequence CCAGAAAGTAGGGACAAGAGACT CAGCAGGAATAGCAGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148} {0: 1, 1: 0, 2: 5, 3: 39, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!