ID: 903372331_903372341

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 903372331 903372341
Species Human (GRCh38) Human (GRCh38)
Location 1:22844736-22844758 1:22844757-22844779
Sequence CCGGATCCCCCAGGAAGCCCCCA CAAGAAGGAAGCCTATAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 598} {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!