ID: 903413779_903413783

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 903413779 903413783
Species Human (GRCh38) Human (GRCh38)
Location 1:23168124-23168146 1:23168147-23168169
Sequence CCGACAGCTGCGGCGGCCGCGGG ACCCCTCCCCGCCCGGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 213} {0: 1, 1: 0, 2: 6, 3: 71, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!