ID: 903413812_903413826

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 903413812 903413826
Species Human (GRCh38) Human (GRCh38)
Location 1:23168227-23168249 1:23168277-23168299
Sequence CCCTCCTCCTCCTGCTGCTGCAG TCCTTCCTCCGGTGCCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 171, 4: 1166} {0: 1, 1: 0, 2: 2, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!