ID: 903443870_903443872

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 903443870 903443872
Species Human (GRCh38) Human (GRCh38)
Location 1:23408322-23408344 1:23408343-23408365
Sequence CCCTGACAGTGATGGGGCAACAG AGCAACCAGTCAGCCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168} {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!