ID: 903461668_903461675

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 903461668 903461675
Species Human (GRCh38) Human (GRCh38)
Location 1:23524999-23525021 1:23525017-23525039
Sequence CCTGGCTCAGTGCCACAACCCAG CCCAGGGAGGTGCCCACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 433} {0: 1, 1: 0, 2: 1, 3: 20, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!