ID: 903468827_903468835

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 903468827 903468835
Species Human (GRCh38) Human (GRCh38)
Location 1:23570754-23570776 1:23570786-23570808
Sequence CCCAGCCCAGATGAGATTTTGGT CAGGGCAGGAGAAAGACTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 98, 4: 1106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!