ID: 903492881_903492888

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 903492881 903492888
Species Human (GRCh38) Human (GRCh38)
Location 1:23743251-23743273 1:23743265-23743287
Sequence CCCGAGCAGCCCCCAGCCCCCAG AGCCCCCAGCGCGCACACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 118, 4: 931} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!