ID: 903510831_903510842

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 903510831 903510842
Species Human (GRCh38) Human (GRCh38)
Location 1:23873873-23873895 1:23873895-23873917
Sequence CCCAGCCTCCTCTGTATTTCCAG GGGACCTGAGGTTACAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 341} {0: 1, 1: 0, 2: 1, 3: 13, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!