ID: 903536275_903536289

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 903536275 903536289
Species Human (GRCh38) Human (GRCh38)
Location 1:24068384-24068406 1:24068430-24068452
Sequence CCAGAGTCCTTTTCCCTGTTCTG TCAGAGTGTAGTGGGCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 339} {0: 1, 1: 0, 2: 1, 3: 17, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!