|
Left Crispr |
Right Crispr |
| Crispr ID |
903538578 |
903538589 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:24083586-24083608
|
1:24083625-24083647
|
| Sequence |
CCCTCTAGAGAACCCTGACTGAT |
GTGGTATGGAGCCTGAACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 21, 1: 830, 2: 1159, 3: 794, 4: 715} |
{0: 1, 1: 0, 2: 1, 3: 10, 4: 167} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|