ID: 903540038_903540043

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 903540038 903540043
Species Human (GRCh38) Human (GRCh38)
Location 1:24091709-24091731 1:24091746-24091768
Sequence CCTGTCCGTGGCAGCATTAGCTA GCCTTCAGAGCCGGCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63} {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!