ID: 903543488_903543496

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 903543488 903543496
Species Human (GRCh38) Human (GRCh38)
Location 1:24109783-24109805 1:24109812-24109834
Sequence CCTAGCCCAACCCCTAGCCCTTC CTATGTCATATGTCCATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 624} {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!