ID: 903543494_903543498

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 903543494 903543498
Species Human (GRCh38) Human (GRCh38)
Location 1:24109800-24109822 1:24109823-24109845
Sequence CCCTTCTGATCTCTATGTCATAT GTCCATTCAAGGCCAGGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 335} {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!