ID: 903548468_903548478

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 903548468 903548478
Species Human (GRCh38) Human (GRCh38)
Location 1:24141676-24141698 1:24141724-24141746
Sequence CCCTCCTCGCTCCTTTTCCTCCT TGTGTTGCTTCGGCACTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 397, 4: 3813} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!