ID: 903573823_903573828

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 903573823 903573828
Species Human (GRCh38) Human (GRCh38)
Location 1:24325505-24325527 1:24325558-24325580
Sequence CCTTGGTCTTATTGGGGGTTTTA TGACTCAGAAGAGACTTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 105} {0: 1, 1: 1, 2: 1, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!