ID: 903575136_903575155

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903575136 903575155
Species Human (GRCh38) Human (GRCh38)
Location 1:24335178-24335200 1:24335225-24335247
Sequence CCCTCTCCCCTGAAGACCCACAG TGGGGGAGGGAGACCTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 70, 4: 476} {0: 1, 1: 1, 2: 4, 3: 31, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!