ID: 903577286_903577302

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903577286 903577302
Species Human (GRCh38) Human (GRCh38)
Location 1:24346743-24346765 1:24346784-24346806
Sequence CCTTACCCCTTGGAGCTAGGTTT GGGGGTAAGGAGGGAACCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 1, 1: 0, 2: 4, 3: 25, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!