ID: 903597019_903597030

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 903597019 903597030
Species Human (GRCh38) Human (GRCh38)
Location 1:24502809-24502831 1:24502835-24502857
Sequence CCTGCGCCGCCGTGCGCGCGCCC CAGAACAGGAGGGGACGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 48, 4: 425} {0: 1, 1: 0, 2: 5, 3: 54, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!