ID: 903605611_903605622

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903605611 903605622
Species Human (GRCh38) Human (GRCh38)
Location 1:24573071-24573093 1:24573112-24573134
Sequence CCAGGTCTAGGAAAGCCAGGCCC CCTGTCTATGGGGCAGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169} {0: 1, 1: 0, 2: 2, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!