ID: 903652993_903653012

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 903652993 903653012
Species Human (GRCh38) Human (GRCh38)
Location 1:24932422-24932444 1:24932475-24932497
Sequence CCCGCGCCCTGCCAGCCGCGGAG CCAGCTGCGGCCCCGGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 413} {0: 1, 1: 0, 2: 3, 3: 39, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!