ID: 903657745_903657748

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 903657745 903657748
Species Human (GRCh38) Human (GRCh38)
Location 1:24959413-24959435 1:24959426-24959448
Sequence CCGCCATCAAAGGGACCTAGCAG GACCTAGCAGACGTGGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83} {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!