ID: 903657746_903657753

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 903657746 903657753
Species Human (GRCh38) Human (GRCh38)
Location 1:24959416-24959438 1:24959447-24959469
Sequence CCATCAAAGGGACCTAGCAGACG GGCAAGCGCCATAGTGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 39} {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!