ID: 903707609_903707616

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 903707609 903707616
Species Human (GRCh38) Human (GRCh38)
Location 1:25298423-25298445 1:25298447-25298469
Sequence CCTCAAAACTTCAATTCAGCCTG GTTTCTTCAGCAGGAGGGCCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 328} {0: 1, 1: 1, 2: 2, 3: 16, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!