|
Left Crispr |
Right Crispr |
| Crispr ID |
903720926 |
903720931 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:25405073-25405095
|
1:25405108-25405130
|
| Sequence |
CCTGTGGTCTCAGCTACTCAGGA |
AGTACTTTTCGGAGCCGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 363, 1: 7447, 2: 61326, 3: 181370, 4: 227197} |
{0: 1, 1: 1, 2: 9, 3: 312, 4: 8041} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|