ID: 903721706_903721710

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 903721706 903721710
Species Human (GRCh38) Human (GRCh38)
Location 1:25410549-25410571 1:25410573-25410595
Sequence CCTCCTGTGCTTCAGTGGGAACC CAGGCGCGCACCACCACGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 146} {0: 176, 1: 6789, 2: 39099, 3: 106930, 4: 182819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!