|
Left Crispr |
Right Crispr |
Crispr ID |
903721706 |
903721710 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:25410549-25410571
|
1:25410573-25410595
|
Sequence |
CCTCCTGTGCTTCAGTGGGAACC |
CAGGCGCGCACCACCACGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 0, 2: 0, 3: 10, 4: 146} |
{0: 176, 1: 6789, 2: 39099, 3: 106930, 4: 182819} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|