ID: 903722070_903722079

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903722070 903722079
Species Human (GRCh38) Human (GRCh38)
Location 1:25413132-25413154 1:25413179-25413201
Sequence CCTTCCTCCCCAAGGCTCTACAC TCAGCCAACAAGATGAAATTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 246} {0: 2, 1: 1, 2: 0, 3: 16, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!