ID: 903740471_903740477

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 903740471 903740477
Species Human (GRCh38) Human (GRCh38)
Location 1:25555845-25555867 1:25555870-25555892
Sequence CCTGCTCATTGCCCTCAAGGAGC CCACTCTAGTTGGGTATAGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 231} {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!