ID: 903740599_903740608

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 903740599 903740608
Species Human (GRCh38) Human (GRCh38)
Location 1:25556377-25556399 1:25556411-25556433
Sequence CCATGCAGAGGGAGTTGCTGTGT GGCCCACTGGGGCTCCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 227} {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!