ID: 903764873_903764877

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903764873 903764877
Species Human (GRCh38) Human (GRCh38)
Location 1:25727703-25727725 1:25727718-25727740
Sequence CCAGTTCTGGGCAGGGAGTGTGG GAGTGTGGGATGCTTAGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 291} {0: 1, 1: 0, 2: 1, 3: 20, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!