ID: 903773348_903773360

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 903773348 903773360
Species Human (GRCh38) Human (GRCh38)
Location 1:25777922-25777944 1:25777967-25777989
Sequence CCTCCTGTGCCCTGGCAGGCATC CCTCCTTTGCCTGGGATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 36, 4: 296} {0: 1, 1: 0, 2: 3, 3: 44, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!