ID: 903779580_903779590

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 903779580 903779590
Species Human (GRCh38) Human (GRCh38)
Location 1:25812779-25812801 1:25812806-25812828
Sequence CCAGTCCTGCTGAGGTGAGGGGC CTGGATCTAAGGGGAGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 234} {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!