ID: 903810936_903810949

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 903810936 903810949
Species Human (GRCh38) Human (GRCh38)
Location 1:26034824-26034846 1:26034875-26034897
Sequence CCTCTTGCCCAGGTATTACCACA TCTGAGGACCCTGGCAGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!