ID: 903814958_903814965

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 903814958 903814965
Species Human (GRCh38) Human (GRCh38)
Location 1:26058189-26058211 1:26058211-26058233
Sequence CCTCTTATCTTATCATCATAAAA ATCAGTAAGAGGAAGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 325} {0: 1, 1: 0, 2: 1, 3: 41, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!