ID: 903833490_903833506

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903833490 903833506
Species Human (GRCh38) Human (GRCh38)
Location 1:26188653-26188675 1:26188700-26188722
Sequence CCCCCACACAGCGCAGCCCACGG GCTGGGCTGGAGTTGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183} {0: 1, 1: 0, 2: 10, 3: 96, 4: 778}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!