ID: 903875128_903875141

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903875128 903875141
Species Human (GRCh38) Human (GRCh38)
Location 1:26468866-26468888 1:26468918-26468940
Sequence CCACCCCAATCCCCACTTTTCTC GGAGCGGAAGAGGCAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 90, 4: 774} {0: 1, 1: 0, 2: 8, 3: 89, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!