ID: 903927462_903927466

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 903927462 903927466
Species Human (GRCh38) Human (GRCh38)
Location 1:26840853-26840875 1:26840876-26840898
Sequence CCCTTCAACTTTCCCTTCAACTG TAGTAGTTATCTCTCTTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 300} {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!