ID: 903935151_903935155

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 903935151 903935155
Species Human (GRCh38) Human (GRCh38)
Location 1:26890294-26890316 1:26890326-26890348
Sequence CCGGACAGCGTCGGAAACGGCGA AGGAAGTCCCGCCCTCACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14} {0: 1, 1: 0, 2: 2, 3: 12, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!