ID: 903936925_903936926

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903936925 903936926
Species Human (GRCh38) Human (GRCh38)
Location 1:26902068-26902090 1:26902109-26902131
Sequence CCACTGTTTTGTGTTCTGGAACA CATCCTTCCCCAAGTGAGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 339} {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!