|
Left Crispr |
Right Crispr |
| Crispr ID |
903941177 |
903941182 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:26932473-26932495
|
1:26932493-26932515
|
| Sequence |
CCGGCCCCCAGCTAATTTTTCTG |
CTGTTTTTTTTGTAGAGATGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 20, 3: 255, 4: 1524} |
{0: 3, 1: 200, 2: 8865, 3: 114860, 4: 219863} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|