ID: 903947953_903947961

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 903947953 903947961
Species Human (GRCh38) Human (GRCh38)
Location 1:26975858-26975880 1:26975896-26975918
Sequence CCAACACAATGCTGGAGCCCCAA TGAATGCTTTCTGATTGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!