ID: 903948967_903948970

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 903948967 903948970
Species Human (GRCh38) Human (GRCh38)
Location 1:26982992-26983014 1:26983006-26983028
Sequence CCTCTAGCACCTTGCACAGTGGC CACAGTGGCTGGTGCATAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 49, 3: 389, 4: 1755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!