ID: 903950531_903950545

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 903950531 903950545
Species Human (GRCh38) Human (GRCh38)
Location 1:26993767-26993789 1:26993811-26993833
Sequence CCGCCGGTGGGGGGCGGGGGATG TGCGGCCCGGGGGCCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 308} {0: 1, 1: 0, 2: 2, 3: 35, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!