ID: 903950532_903950545

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903950532 903950545
Species Human (GRCh38) Human (GRCh38)
Location 1:26993770-26993792 1:26993811-26993833
Sequence CCGGTGGGGGGCGGGGGATGCCG TGCGGCCCGGGGGCCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 286} {0: 1, 1: 0, 2: 2, 3: 35, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!