ID: 903953300_903953302

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 903953300 903953302
Species Human (GRCh38) Human (GRCh38)
Location 1:27008969-27008991 1:27009013-27009035
Sequence CCATCCTTCTTTTTTTTTTTTTT GAGTCCTGATTTTGTAGCTGAGG
Strand - +
Off-target summary {0: 131, 1: 1925, 2: 14373, 3: 61996, 4: 112810} {0: 1, 1: 0, 2: 0, 3: 17, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!